Xodo, Luigi Emilio ; Manzini, Giorgio ; Quadrifoglio, Franco ; Yathindra, Narayanarao ; van der Marel, Gijs A. ; van Boom, Jacques H. (1989) A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment Journal of Molecular Biology, 205 (4). pp. 777-781. ISSN 0022-2836
Full text not available from this repository.
Official URL: http://www.sciencedirect.com/science/article/pii/0...
Related URL: http://dx.doi.org/10.1016/0022-2836(89)90322-7
Abstract
The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.
| Item Type: | Article | 
|---|---|
| Source: | Copyright of this article belongs to Elsevier Science. | 
| ID Code: | 58682 | 
| Deposited On: | 02 Sep 2011 03:48 | 
| Last Modified: | 02 Sep 2011 03:48 | 
Repository Staff Only: item control page

