Pathak, Deepali ; Srivastava, Jyoti ; Samad, Rana ; Parwez, Iqbal ; Kumar, Sudhir ; Ali, Sher (2010) Genome-wide search of the genes tagged with the consensus of 33.6 repeat loci in buffalo Bubalus bubalis employing minisatellite-associated sequence amplification Chromosome Research, 18 (4). pp. 441-458. ISSN 0967-3849
Full text not available from this repository.
Official URL: http://www.springerlink.com/content/rt0j8804787373...
Related URL: http://dx.doi.org/10.1007/s10577-010-9132-0
Abstract
Minisatellites have been implicated with chromatin organization and gene regulation, but mRNA transcripts tagged with these elements have not been systematically characterized. The aim of the present study was to gain an insight into the transcribing genes associated with consensus of 33.6 repeat loci across the tissues in water buffalo, Bubalus bubalis. Using cDNA from spermatozoa and eight different somatic tissues and an oligo primer based on two units of consensus of 33.6 repeat loci (5′ CCTCCAGCCCTCCTCCAGCCCT 3′), we conducted minisatellite-associated sequence amplification (MASA) and identified 29 mRNA transcripts. These transcripts were cloned and sequenced. Blast search of the individual mRNA transcript revealed sequence homologies with various transcribing genes and contigs in the database. Using real-time PCR, we detected the highest expression of nine mRNA transcripts in spermatozoa and one each in liver and lung. Further, 21 transcripts were found to be conserved across the species; seven were specific to bovid whereas one was exclusive to the buffalo genome. The present work demonstrates innate potentials of MASA in accessing several functional genes simultaneously without screening the cDNA library. This approach may be exploited for the development of tissue-specific mRNA fingerprints in the context of genome analysis and functional and comparative genomics.
| Item Type: | Article |
|---|---|
| Source: | Copyright of this article belongs to Springer-Verlag. |
| Keywords: | Buffalo Genome; 33.6 Minisatellites; Satellite-tagged Transcripts; Relative Expression; Fluorescence in Situ Hybridization |
| ID Code: | 20794 |
| Deposited On: | 20 Nov 2010 13:33 |
| Last Modified: | 03 Jan 2011 11:34 |
Repository Staff Only: item control page

Dimensions
Dimensions