Azfer, Asim ; Bashamboo, Anu ; Ahmed, Nasser ; Ali, Sher (1999) Random amplification of polymorphic DNA with conserved sequences reveals genome-specific monomorphic amplicons: implications in clad identification Journal of Biosciences, 24 (1). pp. 35-41. ISSN 0250-5991
Full text not available from this repository.
Official URL: http://www.ias.ac.in/jbiosci/march1999/article6.ht...
Related URL: http://dx.doi.org/10.1007/BF02941104
Abstract
The enzymatic amplification of genomic DNA with an arbitrary primer generates informative band profile useful for genome analysis. We used a set of synthetic oligodeoxyribonucleotide primers OAT15.2 (GACA)3.75, OAT18. 2 (GACA)4.5, OAT24.2 (GACA)6, OAT36 (GACA)9, comprising 4-9 consecutive units of GACA repeat, O33.15 (CACCTCTCCACCTGCC) and 033.6 (CCTCCAGCCCTCCTCCAGCCCT) for RAPD reactions of genomic DNA from different sources. The GACA based oligos of 15 and 18 base residues generated discernible genome specific amplicons whereas primers larger than 18 bases revealed smeary signals. The other oligos O33.15 and O33.6 also generated genome specific amplicons with more bands compared with those obtained from OAT15.2 or OAT18.2. The presence of OAT15.1 (GATA)3.75 and OAT15.2 (GACA)3.75 sequences in different genomes were ascertained by independent dot-blot hybridization prior to using them for RAPD reactions. The RAPD amplicons generated by evolutionarily conserved primer(s) or sequences shared by many species may be useful for clad identification in controversial systematics, comparative genome analysis, and for establishing the phylogenetic status of an organism.
| Item Type: | Article |
|---|---|
| Source: | Copyright of this article belongs to Indian Academy of Sciences. |
| Keywords: | Genome Analysis; Conserved Sequences; Rapd; Monomorphic Amplicons; Molecular Systematics; Clad Identification |
| ID Code: | 20748 |
| Deposited On: | 20 Nov 2010 13:38 |
| Last Modified: | 29 Jan 2011 05:53 |
Repository Staff Only: item control page

Dimensions
Dimensions