Ahamed, Jasimuddin ; Gangopadhyay, Jayanti ; Kundu, Manikuntala ; Sinha, Ajay K. (1999) Mechanisms of quinolone resistance in clinical isolates of Shigella dysenteriae Antimicrobial Agents and Chemotherapy, 43 (9). pp. 2333-2334. ISSN 0066-4804
Preview |
PDF
- Other
40kB |
Official URL: http://aac.asm.org/content/43/9/2333.short
Abstract
In gram-negative bacteria, gyrase and topoisomerase IV are primary and secondary targets, respectively, of the fluoroquinolones. In addition to the mutations in the genes encoding the target enzymes (1, 4), quinolone resistance may also be associated with increased efflux of the drugs (2, 5). Possible mechanisms of quinolone resistance were investigated in clinical isolates of Shigella dysenteriae obtained from the International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh (AK) and the National Institute of Cholera and Enteric Diseases, Calcutta, India (CI, DS, IPB, and IMC). The quinolone resistance-determining regions (QRDR) of gyrA and parC were amplified with the primer pairs 5′TACACCGG TCAACAT TGAGG3′-5′T TAATGAT TGCCGCCG TCGG3′ and 5′GTATGCGATGTCTGAACTGGGCCTG3′-5′CGACAACCGGGATTCGGTG3′, respectively. The Ser83→Leu substitution appeared sufficient to confer high-level nalidixic acid resistance (MIC > 250 μg/ml) as determined by standard methods (3) (Table1). Four strains—DS-1, DS-2, CI-1, and CI-2—for which the norfloxacin MICs were 2 μg/ml and the ciprofloxacin MICs were between 0.5 and 1 μg/ml harbored the mutation Asp87→Gly in GyrA. None of the isolates examined had any mutations in the QRDR-encoding part of the parC gene.
| Item Type: | Article |
|---|---|
| Source: | Copyright of this article belongs to American Society for Microbiology. |
| ID Code: | 102775 |
| Deposited On: | 11 Mar 2017 13:16 |
| Last Modified: | 11 Mar 2017 13:16 |
Repository Staff Only: item control page

PlumX Metrics
PlumX Metrics